
Scikit Bio
- 109 installs
- 32.7k repo stars
- Updated August 3, 2026
- k-dense-ai/claude-scientific-skills
Run bioinformatics workflows with scikit-bio for sequence analysis, phylogenetics, and biological data processing in Python pipelines.
About
Agent skill for implementing bioinformatics analyses with scikit-bio, covering sequence processing, phylogenetic methods, and biological data workflows in production Python code.
- sequence analysis
- phylogenetics
- bioinformatics pipelines
- scikit-bio API
Scikit Bio by the numbers
- 109 all-time installs (skills.sh)
- Ranked #95 of 290 Python skills by installs in the Skillselion catalog
- Data as of Aug 5, 2026 (Skillselion catalog sync)
npx skills add https://github.com/k-dense-ai/claude-scientific-skills --skill scikit-bioAdd your badge
Show developers this skill is listed on Skillselion. Paste this into your README.
| Installs | 109 |
|---|---|
| repo stars | ★ 32.7k |
| Last updated | August 3, 2026 |
| Repository | k-dense-ai/claude-scientific-skills ↗ |
What it does
Run bioinformatics workflows with scikit-bio for sequence analysis, phylogenetics, and biological data processing in Python pipelines.
Files
scikit-bio
Overview
scikit-bio is a comprehensive Python library for working with biological data. Apply this skill for bioinformatics analyses spanning sequence manipulation, alignment, phylogenetics, microbial ecology, and multivariate statistics.
When to Use This Skill
This skill should be used when the user:
- Works with biological sequences (DNA, RNA, protein)
- Needs to read/write biological file formats (FASTA, FASTQ, GenBank, Newick, BIOM, etc.)
- Performs sequence alignments or searches for motifs
- Constructs or analyzes phylogenetic trees
- Calculates diversity metrics (alpha/beta diversity, UniFrac distances)
- Performs ordination analysis (PCoA, CCA, RDA)
- Runs statistical tests on biological/ecological data (PERMANOVA, ANOSIM, Mantel)
- Analyzes microbiome or community ecology data
- Works with protein embeddings from language models
- Needs to manipulate biological data tables
Core Capabilities
1. Sequence Manipulation
Work with biological sequences using specialized classes for DNA, RNA, and protein data.
Key operations:
- Read/write sequences from FASTA, FASTQ, GenBank, EMBL formats
- Sequence slicing, concatenation, and searching
- Reverse complement, transcription (DNA→RNA), and translation (RNA→protein)
- Find motifs and patterns using regex
- Calculate distances (Hamming, k-mer based)
- Handle sequence quality scores and metadata
Common patterns:
import skbio
# Read sequences from file
seq = skbio.DNA.read('input.fasta')
# Sequence operations
rc = seq.reverse_complement()
rna = seq.transcribe()
protein = rna.translate()
# Find motifs
motif_positions = seq.find_with_regex('ATG[ACGT]{3}')
# Check for properties
has_degens = seq.has_degenerates()
seq_no_gaps = seq.degap()Important notes:
- Use
DNA,RNA,Proteinclasses for grammared sequences with validation - Use
Sequenceclass for generic sequences without alphabet restrictions - Quality scores automatically loaded from FASTQ files into positional metadata
- Metadata types: sequence-level (ID, description), positional (per-base), interval (regions/features)
2. Sequence Alignment
Perform pairwise and multiple sequence alignments using the pair_align engine (introduced in scikit-bio 0.7.0), a versatile and efficient dynamic-programming aligner.
Key capabilities:
- Global, local, and semi-global alignment (free ends configurable) in one function
- Convenience wrappers
pair_align_nucl(BLASTN-like) andpair_align_prot(BLASTP-like) - Configurable scoring: match/mismatch tuple or named substitution matrix; linear or affine gap penalties
PairAlignPathresults carry CIGAR strings and convert to aligned sequences- Multiple sequence alignment storage and manipulation with
TabularMSA
Common patterns:
from skbio import DNA, Protein
from skbio.alignment import pair_align_nucl, pair_align_prot, pair_align, TabularMSA
# Nucleotide alignment with BLASTN-like defaults
seq1, seq2 = DNA('ACTACCAGATTACTTACGGATCAGG'), DNA('CGAAACTACTAGATTACGGATCTTA')
aln = pair_align_nucl(seq1, seq2)
aln.score # alignment score (float)
path = aln.paths[0] # PairAlignPath (repr shows CIGAR)
aligned_seqs = path.to_aligned((seq1, seq2)) # list of gapped strings
# Build a TabularMSA from the alignment path + original sequences
msa = TabularMSA.from_path_seqs(path, (seq1, seq2))
# Customize the algorithm via pair_align (default mode='global')
aln = pair_align(seq1, seq2, mode='local') # Smith-Waterman
aln = pair_align(seq1, seq2, sub_score=(2, -3), gap_cost=(5, 2)) # affine gaps
aln = pair_align(seq1, seq2, sub_score='NUC.4.4', gap_cost=3) # substitution matrix, linear gap
# Protein alignment (BLASTP-like, BLOSUM62)
aln = pair_align_prot(Protein('HEAGAWGHEE'), Protein('PAWHEAE'))
# Read a multiple alignment from file and summarize
msa = TabularMSA.read('alignment.fasta', constructor=DNA)
consensus = msa.consensus()Important notes:
pair_alignreplaces the removed SSW wrapper (local_pairwise_align_ssw,StripedSmithWaterman) and the deprecated pure-Python aligners (global_pairwise_align,local_pairwise_align_nucleotide, etc.)- The result is a
PairAlignResultthat also unpacks asscore, paths, matrices(usekeep_matrices=Trueto retain the DP matrix) sub_scoreaccepts a(match, mismatch)tuple or a matrix name (e.g.,'NUC.4.4','BLOSUM62');gap_costaccepts a single number (linear) or(open, extend)tuple (affine)- Parse external CIGAR strings with
PairAlignPath.from_cigar('1I8M2D5M2I'); score an existing alignment withalign_score(...)and build a distance matrix from an MSA withalign_dists(...)
3. Phylogenetic Trees
Construct, manipulate, and analyze phylogenetic trees representing evolutionary relationships.
Key capabilities:
- Tree construction from distance matrices (UPGMA/WPGMA, Neighbor Joining, GME, BME)
- Tree rearrangement with nearest neighbor interchange (
nni) - Tree manipulation (pruning, rerooting, traversal)
- Distance calculations (patristic via
cophenet, Robinson-Foulds viacompare_rfd) - ASCII visualization
- Newick format I/O
Common patterns:
from skbio import TreeNode
from skbio.tree import nj, upgma, gme, bme, rf_dists
# Read tree from file
tree = TreeNode.read('tree.nwk')
# Construct tree from distance matrix
tree = nj(distance_matrix)
# Tree operations
subtree = tree.shear(['taxon1', 'taxon2', 'taxon3'])
tips = [node for node in tree.tips()]
lca = tree.lca(['taxon1', 'taxon2'])
# Calculate distances
patristic_dist = tree.find('taxon1').distance(tree.find('taxon2'))
cophenetic_dm = tree.cophenet() # patristic distance matrix among tips
# Compare two trees (Robinson-Foulds)
rf_distance = tree.compare_rfd(other_tree)
# Pairwise RF distances among many trees -> DistanceMatrix
rf_dm = rf_dists([tree, other_tree, third_tree])Important notes:
- Use
nj()for neighbor joining (classic phylogenetic method) - Use
upgma()for UPGMA/WPGMA (assumes molecular clock) - GME and BME are highly scalable for large trees; refine topology with
nni() cophenet()(formerlytip_tip_distances) returns the patristic distance matrix;compare_rfd()is the Robinson-Foulds method (compare_wrfd/compare_cophenetfor weighted/cophenetic variants)lca()is the lowest common ancestor;lowest_common_ancestorremains as an alias- Trees can be rooted or unrooted; some metrics require specific rooting
4. Diversity Analysis
Calculate alpha and beta diversity metrics for microbial ecology and community analysis.
Key capabilities:
- Alpha diversity: richness (
sobs,observed_features,chao1,ace), Shannon, Simpson, Hill numbers (hill), Faith's PD (faith_pd), generalized PD (phydiv), Pielou's evenness - Beta diversity: Bray-Curtis, Jaccard, weighted/unweighted UniFrac, Euclidean distances
- Phylogenetic diversity metrics (require tree input)
- Rarefaction and subsampling
- Integration with ordination and statistical tests
Common patterns:
from skbio.diversity import alpha_diversity, beta_diversity
# Alpha diversity (phylogenetic metrics take taxa= for tip-name mapping)
alpha = alpha_diversity('shannon', counts_matrix, ids=sample_ids)
faith_pd = alpha_diversity('faith_pd', counts_matrix, ids=sample_ids,
tree=tree, taxa=feature_ids)
# Beta diversity
bc_dm = beta_diversity('braycurtis', counts_matrix, ids=sample_ids)
unifrac_dm = beta_diversity('unweighted_unifrac', counts_matrix,
ids=sample_ids, tree=tree, taxa=feature_ids)
# Get available metrics
from skbio.diversity import get_alpha_diversity_metrics
print(get_alpha_diversity_metrics())Important notes:
- Counts must be integers representing abundances, not relative frequencies
- The phylogenetic-metric argument is
taxa=(renamed fromotu_idsin 0.6.0; the old name is a deprecated alias);observed_otusis nowobserved_features(orsobs) counts_matrixmay be any table-like input (NumPy array, pandas/polars DataFrame, BIOMTable, or AnnData) via the dispatch system- Phylogenetic metrics (Faith's PD, UniFrac) require tree and taxa-to-tip mapping
- Use
partial_beta_diversity()for specific sample pairs, orblock_beta_diversity()for large block-decomposed calculations - Alpha diversity returns a
pandas.Series, beta diversity returns aDistanceMatrix
5. Ordination Methods
Reduce high-dimensional biological data to visualizable lower-dimensional spaces.
Key capabilities:
- PCoA (Principal Coordinate Analysis) from distance matrices
- CA (Correspondence Analysis) for contingency tables
- CCA (Canonical Correspondence Analysis) with environmental constraints
- RDA (Redundancy Analysis) for linear relationships
- Biplot projection for feature interpretation
Common patterns:
from skbio.stats.ordination import pcoa, cca
import skbio
# PCoA from distance matrix (limit dimensions for large matrices)
pcoa_results = pcoa(distance_matrix, dimensions=3)
pc1 = pcoa_results.samples['PC1']
pc2 = pcoa_results.samples['PC2']
# Built-in scatter plot colored by a metadata column
fig = pcoa_results.plot(sample_metadata, column='bodysite')
# CCA with environmental variables
cca_results = cca(species_matrix, environmental_matrix)
# Save/load ordination results
pcoa_results.write('ordination.txt')
results = skbio.OrdinationResults.read('ordination.txt')Important notes:
- PCoA works with any distance/dissimilarity matrix; pass
dimensionsas an int (count) or a float in (0, 1] (fraction of cumulative variance to retain) OrdinationResultsexposes pandas-based attributes:samples,features,eigvals,proportion_explained,biplot_scores,sample_constraints- CCA reveals environmental drivers of community composition
OrdinationResults.plot()produces a matplotlib figure; results also integrate with seaborn/plotly
6. Statistical Testing
Perform hypothesis tests specific to ecological and biological data.
Key capabilities:
- PERMANOVA: test group differences using distance matrices
- ANOSIM: alternative test for group differences
- PERMDISP: test homogeneity of group dispersions
- Mantel test: correlation between distance matrices
- Bioenv: find environmental variables correlated with distances
- Differential abundance:
ancom,dirmult_ttest, anddirmult_lme(longitudinal mixed-effects) inskbio.stats.composition
Common patterns:
from skbio.stats.distance import permanova, anosim, mantel
# Test if groups differ significantly
permanova_results = permanova(distance_matrix, grouping, permutations=999)
print(f"p-value: {permanova_results['p-value']}")
# ANOSIM test
anosim_results = anosim(distance_matrix, grouping, permutations=999)
# Mantel test between two distance matrices
mantel_results = mantel(dm1, dm2, method='pearson', permutations=999)
print(f"Correlation: {mantel_results[0]}, p-value: {mantel_results[1]}")
# Differential abundance on a feature table (raw counts recommended)
from skbio.stats.composition import dirmult_ttest
da = dirmult_ttest(counts_table, grouping, treatment='caseA', reference='control')Important notes:
- Permutation tests provide non-parametric significance testing
- Use 999+ permutations for robust p-values
- PERMANOVA sensitive to dispersion differences; pair with PERMDISP
- Mantel tests assess matrix correlation (e.g., geographic vs genetic distance)
- Supply differential-abundance tests with raw counts, not pre-normalized proportions, to preserve magnitude information
7. File I/O and Format Conversion
Read and write 19+ biological file formats with automatic format detection.
Supported formats:
- Sequences: FASTA, FASTQ, GenBank, EMBL, QSeq
- Alignments: Clustal, PHYLIP, Stockholm
- Trees: Newick
- Tables: BIOM (HDF5 and JSON)
- Distances: delimited square matrices
- Analysis: BLAST+6/7, GFF3, Ordination results
- Metadata: TSV/CSV with validation
Common patterns:
import skbio
# Read with automatic format detection
seq = skbio.DNA.read('file.fasta', format='fasta')
tree = skbio.TreeNode.read('tree.nwk')
# Write to file
seq.write('output.fasta', format='fasta')
# Generator for large files (memory efficient)
for seq in skbio.io.read('large.fasta', format='fasta', constructor=skbio.DNA):
process(seq)
# Convert formats
seqs = list(skbio.io.read('input.fastq', format='fastq', constructor=skbio.DNA))
skbio.io.write(seqs, format='fasta', into='output.fasta')Important notes:
- Use generators for large files to avoid memory issues
- Format can be auto-detected when
intoparameter specified - Some objects can be written to multiple formats
- Support for stdin/stdout piping with
verify=False
8. Distance Matrices
Create and manipulate distance/dissimilarity matrices with statistical methods.
Key capabilities:
- Store symmetric (
DistanceMatrix, hollow diagonal) or general pairwise (PairwiseMatrix) data - ID-based indexing and slicing
- Integration with diversity, ordination, and statistical tests
- Read/write delimited text format
Common patterns:
from skbio import DistanceMatrix
import numpy as np
# Create from array
data = np.array([[0, 1, 2], [1, 0, 3], [2, 3, 0]])
dm = DistanceMatrix(data, ids=['A', 'B', 'C'])
# Access distances
dist_ab = dm['A', 'B']
row_a = dm['A']
# Read from file
dm = DistanceMatrix.read('distances.txt')
# Use in downstream analyses
pcoa_results = pcoa(dm)
permanova_results = permanova(dm, grouping)Important notes:
DistanceMatrixenforces symmetry and a zero (hollow) diagonal; it is a subclass ofSymmetricMatrixPairwiseMatrix(renamed fromDissimilarityMatrix, which is kept as a deprecated alias) allows general/asymmetric values- IDs enable integration with metadata and biological knowledge
- Compatible with pandas, numpy, and scikit-learn
9. Biological Tables
Work with feature tables (OTU/ASV tables) common in microbiome research.
Key capabilities:
- BIOM format I/O (HDF5 and JSON) via the native
Tableclass - Table dispatch system (0.7.0+): functions accept any
table_likeinput — BIOMTable, pandas/polars DataFrame, NumPy array, or AnnData — without explicit conversion - Data augmentation techniques (
phylomix,mixup,aitchison_mixup,compos_cutmix) - Sample/feature filtering and normalization
- Metadata integration
Common patterns:
from skbio import Table
from skbio.diversity import beta_diversity
# Read BIOM table
table = Table.read('table.biom')
# Access data
sample_ids = table.ids(axis='sample')
feature_ids = table.ids(axis='observation')
counts = table.matrix_data
# Filter
filtered = table.filter(sample_ids_to_keep, axis='sample')
# Pass table-like objects directly to scikit-bio drivers (dispatch system)
import pandas as pd
df = pd.read_table('data.tsv', index_col=0) # samples x features
bdiv = beta_diversity('braycurtis', df) # no manual conversion neededImportant notes:
- BIOM tables are standard in QIIME 2 workflows
- Rows typically represent samples, columns represent features (OTUs/ASVs)
- Supports sparse and dense representations
- With the dispatch system, functions return the same format as their input, or a user-specified output format
10. Protein Embeddings
Work with protein language model embeddings for downstream analysis.
Key capabilities:
- Store embeddings from protein language models (ESM, ProtTrans, etc.)
- Convert embeddings to distance matrices
- Generate ordination objects for visualization
- Export to numpy/pandas for ML workflows
Common patterns:
from skbio.embedding import ProteinEmbedding, ProteinVector
# Create embedding from array
embedding = ProteinEmbedding(embedding_array, sequence_ids)
# Convert to distance matrix for analysis
dm = embedding.to_distances(metric='euclidean')
# PCoA visualization of embedding space
pcoa_results = embedding.to_ordination(metric='euclidean', method='pcoa')
# Export for machine learning
array = embedding.to_array()
df = embedding.to_dataframe()Important notes:
- Embeddings bridge protein language models with traditional bioinformatics
- Compatible with scikit-bio's distance/ordination/statistics ecosystem
- SequenceEmbedding and ProteinEmbedding provide specialized functionality
- Useful for sequence clustering, classification, and visualization
Best Practices
Installation
uv pip install scikit-bioRequires Python 3.10+ and NumPy 2.0+. Pre-compiled wheels are published for each release since 0.7.0, so most platforms install without a compiler. Conda users can instead run conda install -c conda-forge scikit-bio.
Performance Considerations
- Use generators for large sequence files to minimize memory usage
- For massive phylogenetic trees, prefer GME or BME over NJ
- Beta diversity calculations can be parallelized with
partial_beta_diversity() - BIOM format (HDF5) more efficient than JSON for large tables
Integration with Ecosystem
- Sequences interoperate with Biopython via standard formats
- Tables integrate with pandas, polars, and AnnData
- Distance matrices compatible with scikit-learn
- Ordination results visualizable with matplotlib/seaborn/plotly
- Works seamlessly with QIIME 2 artifacts (BIOM, trees, distance matrices)
Common Workflows
1. Microbiome diversity analysis: Read BIOM table → Calculate alpha/beta diversity → Ordination (PCoA) → Statistical testing (PERMANOVA) 2. Phylogenetic analysis: Read sequences → Align → Build distance matrix → Construct tree → Calculate phylogenetic distances 3. Sequence processing: Read FASTQ → Quality filter → Trim/clean → Find motifs → Translate → Write FASTA 4. Comparative genomics: Read sequences → Pairwise alignment → Calculate distances → Build tree → Analyze clades
Reference Documentation
For detailed API information, parameter specifications, and advanced usage examples, refer to references/api_reference.md which contains comprehensive documentation on:
- Complete method signatures and parameters for all capabilities
- Extended code examples for complex workflows
- Troubleshooting common issues
- Performance optimization tips
- Integration patterns with other libraries
Additional Resources
- Official documentation: https://scikit.bio/docs/latest/
- GitHub repository: https://github.com/scikit-bio/scikit-bio
- Changelog: https://github.com/scikit-bio/scikit-bio/blob/main/CHANGELOG.md
- Reference paper: "scikit-bio: a fundamental Python library for biological omic data," Nature Methods (2025), https://www.nature.com/articles/s41592-025-02981-z
- Forum support: https://forum.qiime2.org (scikit-bio is part of QIIME 2 ecosystem)
scikit-bio API Reference
This document provides detailed API information, advanced examples, and troubleshooting guidance for working with scikit-bio.
Table of Contents
1. Sequence Classes 2. Alignment Methods 3. Phylogenetic Trees 4. Diversity Metrics 5. Ordination 6. Statistical Tests 7. Distance Matrices 8. File I/O 9. Troubleshooting
Sequence Classes
DNA, RNA, and Protein Classes
from skbio import DNA, RNA, Protein, Sequence
# Creating sequences
dna = DNA('ATCGATCG', metadata={'id': 'seq1', 'description': 'Example'})
rna = RNA('AUCGAUCG')
protein = Protein('ACDEFGHIKLMNPQRSTVWY')
# Sequence operations
dna_rc = dna.reverse_complement() # Reverse complement
rna = dna.transcribe() # DNA -> RNA
protein = rna.translate() # RNA -> Protein
# Using genetic code tables
protein = rna.translate(genetic_code=11) # Bacterial codeSequence Searching and Pattern Matching
# Find motifs using regex
dna = DNA('ATGCGATCGATGCATCG')
motif_locs = dna.find_with_regex('ATG.{3}') # Start codons
# Find all positions
import re
for match in re.finditer('ATG', str(dna)):
print(f"ATG found at position {match.start()}")
# k-mer counting
from skbio.sequence import _motifs
kmers = dna.kmer_frequencies(k=3)Handling Sequence Metadata
# Sequence-level metadata
dna = DNA('ATCG', metadata={'id': 'seq1', 'source': 'E. coli'})
print(dna.metadata['id'])
# Positional metadata (per-base quality scores from FASTQ)
from skbio import DNA
seqs = DNA.read('reads.fastq', format='fastq', phred_offset=33)
quality_scores = seqs.positional_metadata['quality']
# Interval metadata (features/annotations)
dna.interval_metadata.add([(5, 15)], metadata={'type': 'gene', 'name': 'geneA'})Distance Calculations
from skbio import DNA
seq1 = DNA('ATCGATCG')
seq2 = DNA('ATCG--CG')
# Hamming distance (default)
dist = seq1.distance(seq2)
# Custom distance function
from skbio.sequence.distance import kmer_distance
dist = seq1.distance(seq2, metric=kmer_distance)Alignment Methods
Pairwise Alignment
scikit-bio 0.7.0 introduced pair_align, a single fast engine for global, local, and semi-global alignment. The convenience wrappers pair_align_nucl and pair_align_prot ship with BLASTN/BLASTP-like scoring. The old SSW wrapper (local_pairwise_align_ssw, StripedSmithWaterman) was removed, and the pure-Python global_pairwise_align/local_pairwise_align_* functions are deprecated.
from skbio import DNA, Protein
from skbio.alignment import pair_align_nucl, pair_align_prot, pair_align, align_score
# Nucleotide alignment with BLASTN-like defaults
seq1 = DNA('ATCGATCGATCG')
seq2 = DNA('ATCGGGGATCG')
aln = pair_align_nucl(seq1, seq2)
# Inspect the result (PairAlignResult: score + paths [+ matrices])
print(f"Score: {aln.score}")
path = aln.paths[0] # PairAlignPath; repr shows the CIGAR
aligned_seqs = path.to_aligned((seq1, seq2)) # list of gapped strings
# Global alignment with custom affine scoring via pair_align
aln = pair_align(
seq1, seq2,
mode='global', # 'global' (default), 'local', or semi-global via free_ends
sub_score=(2, -3), # (match, mismatch)
gap_cost=(5, 2), # (open, extend) -> affine; a single number -> linear
)
# Use a named substitution matrix instead of match/mismatch scores
aln = pair_align(seq1, seq2, mode='global', sub_score='NUC.4.4', gap_cost=3)
# Protein alignment with BLASTP-like defaults (BLOSUM62)
protein_query = Protein('ACDEFGHIKLMNPQRSTVWY')
protein_target = Protein('ACDEFMNPQRSTVWY')
aln = pair_align_prot(protein_query, protein_target)
# Re-score an existing alignment with the same parameters
score = align_score((aln.paths[0], (protein_query, protein_target)),
sub_score='BLOSUM62', gap_cost=(11, 1))
# PairAlignResult also unpacks as a tuple
score, (path,), _ = pair_align_nucl(seq1, seq2)Multiple Sequence Alignment
from skbio.alignment import TabularMSA, pair_align_nucl
from skbio import DNA
# Read MSA from file
msa = TabularMSA.read('alignment.fasta', constructor=DNA)
# Build a TabularMSA from a pairwise alignment path + original sequences
score, (path,), _ = pair_align_nucl(DNA('ATCGATCG'), DNA('ATCGGGGATCG'))
msa = TabularMSA.from_path_seqs(path, (DNA('ATCGATCG'), DNA('ATCGGGGATCG')))
# Create MSA manually
seqs = [
DNA('ATCG--'),
DNA('ATGG--'),
DNA('ATCGAT')
]
msa = TabularMSA(seqs)
# MSA operations
consensus = msa.consensus()
majority_consensus = msa.majority_consensus()
# Calculate conservation
conservation = msa.conservation()
# Access sequences
first_seq = msa[0]
column = msa[:, 2] # Third column
# Filter gaps
degapped_msa = msa.omit_gap_positions(maximum_gap_frequency=0.5)
# Calculate position-specific scores
position_entropies = msa.position_entropies()CIGAR Strings and Alignment Paths
from skbio.alignment import PairAlignPath, AlignPath, pair_align_nucl
from skbio import DNA
# Parse a CIGAR string into a pairwise alignment path
path = PairAlignPath.from_cigar('10M2I5M3D10M')
print(repr(path)) # <PairAlignPath, ..., CIGAR: '10M2I5M3D10M'>
# A path produced by pair_align already carries its CIGAR
aln = pair_align_nucl(DNA('ATCGATCG'), DNA('ATCGGGGATCG'))
cigar_string = aln.paths[0].cigar
# AlignPath generalizes to >2 sequences (e.g., from aligned strings)
path3 = AlignPath.from_aligned(['CGTCGTGC', 'CA--GT-C', 'CGTCGT-T'])
# Parse CIGAR output from external tools such as parasail
# path = PairAlignPath.from_cigar(res.cigar.decode)Phylogenetic Trees
Tree Construction
from skbio import TreeNode, DistanceMatrix
from skbio.tree import nj, upgma
# Distance matrix
dm = DistanceMatrix([[0, 5, 9, 9],
[5, 0, 10, 10],
[9, 10, 0, 8],
[9, 10, 8, 0]],
ids=['A', 'B', 'C', 'D'])
# Neighbor joining
nj_tree = nj(dm)
# UPGMA (assumes molecular clock)
upgma_tree = upgma(dm)
# Balanced Minimum Evolution (scalable for large trees)
from skbio.tree import bme
bme_tree = bme(dm)Tree Manipulation
from skbio import TreeNode
# Read tree
tree = TreeNode.read('tree.nwk', format='newick')
# Traversal
for node in tree.traverse():
print(node.name)
# Preorder, postorder, levelorder
for node in tree.preorder():
print(node.name)
# Get tips only
tips = list(tree.tips())
# Find specific node
node = tree.find('taxon_name')
# Root tree at midpoint
rooted_tree = tree.root_at_midpoint()
# Prune tree to specific taxa
pruned = tree.shear(['taxon1', 'taxon2', 'taxon3'])
# Get subtree
lca = tree.lowest_common_ancestor(['taxon1', 'taxon2'])
subtree = lca.copy()
# Add/remove nodes
parent = tree.find('parent_name')
child = TreeNode(name='new_child', length=0.5)
parent.append(child)
# Remove node
node_to_remove = tree.find('taxon_to_remove')
node_to_remove.parent.remove(node_to_remove)Tree Distances and Comparisons
# Patristic distance (branch-length distance) between two nodes
node1 = tree.find('taxon1')
node2 = tree.find('taxon2')
patristic = node1.distance(node2)
# Cophenetic (patristic) distance matrix among all tips
# cophenet() replaces the former tip_tip_distances()
cophenetic_dm = tree.cophenet()
# Robinson-Foulds distance between two trees (compare_rfd, added in 0.6.3)
rf_dist = tree.compare_rfd(other_tree) # count (float)
rf_prop = tree.compare_rfd(other_tree, proportion=True) # normalized to [0, 1]
# Weighted Robinson-Foulds and cophenetic-correlation comparisons
wrf = tree.compare_wrfd(other_tree)
coph = tree.compare_cophenet(other_tree)
# Pairwise RF distances among many trees -> DistanceMatrix
from skbio.tree import rf_dists
rf_dm = rf_dists([tree, other_tree, third_tree])Tree Visualization
# ASCII art visualization
print(tree.ascii_art())
# For advanced visualization, export to external tools
tree.write('tree.nwk', format='newick')
# Then use ete3, toytree, or ggtree for publication-quality figuresDiversity Metrics
Alpha Diversity
from skbio.diversity import alpha_diversity, get_alpha_diversity_metrics
import numpy as np
# Sample count data (samples x features)
counts = np.array([
[10, 5, 0, 3],
[2, 0, 8, 4],
[5, 5, 5, 5]
])
sample_ids = ['Sample1', 'Sample2', 'Sample3']
# List available metrics
print(get_alpha_diversity_metrics())
# Calculate various alpha diversity metrics
shannon = alpha_diversity('shannon', counts, ids=sample_ids)
simpson = alpha_diversity('simpson', counts, ids=sample_ids)
observed = alpha_diversity('observed_features', counts, ids=sample_ids) # was 'observed_otus'
chao1 = alpha_diversity('chao1', counts, ids=sample_ids)
hill_q2 = alpha_diversity('hill', counts, ids=sample_ids) # effective number of species
# Phylogenetic alpha diversity (requires tree). Note: taxa= replaces otu_ids=
from skbio import TreeNode
tree = TreeNode.read('tree.nwk')
feature_ids = ['OTU1', 'OTU2', 'OTU3', 'OTU4']
faith_pd = alpha_diversity('faith_pd', counts, ids=sample_ids,
tree=tree, taxa=feature_ids)Beta Diversity
from skbio.diversity import beta_diversity, partial_beta_diversity
# Beta diversity (all pairwise comparisons)
bc_dm = beta_diversity('braycurtis', counts, ids=sample_ids)
# Jaccard (presence/absence)
jaccard_dm = beta_diversity('jaccard', counts, ids=sample_ids)
# Phylogenetic beta diversity (taxa= replaces the deprecated otu_ids=)
unifrac_dm = beta_diversity('unweighted_unifrac', counts,
ids=sample_ids,
tree=tree,
taxa=feature_ids)
weighted_unifrac_dm = beta_diversity('weighted_unifrac', counts,
ids=sample_ids,
tree=tree,
taxa=feature_ids)
# Compute only specific pairs (more efficient)
pairs = [('Sample1', 'Sample2'), ('Sample1', 'Sample3')]
partial_dm = partial_beta_diversity('braycurtis', counts,
ids=sample_ids,
id_pairs=pairs)Rarefaction and Subsampling
from skbio.diversity import subsample_counts
# Rarefy to minimum depth
min_depth = counts.min(axis=1).max()
rarefied = [subsample_counts(row, n=min_depth) for row in counts]
# Multiple rarefactions for confidence intervals
import numpy as np
rarefactions = []
for i in range(100):
rarefied_counts = np.array([subsample_counts(row, n=1000) for row in counts])
shannon_rare = alpha_diversity('shannon', rarefied_counts)
rarefactions.append(shannon_rare)
# Calculate mean and std
mean_shannon = np.mean(rarefactions, axis=0)
std_shannon = np.std(rarefactions, axis=0)Ordination
Principal Coordinate Analysis (PCoA)
from skbio.stats.ordination import pcoa
from skbio import DistanceMatrix
import numpy as np
# PCoA from distance matrix
dm = DistanceMatrix(...)
pcoa_results = pcoa(dm)
# Access coordinates
pc1 = pcoa_results.samples['PC1']
pc2 = pcoa_results.samples['PC2']
# Proportion explained
prop_explained = pcoa_results.proportion_explained
# Eigenvalues
eigenvalues = pcoa_results.eigvals
# Save results
pcoa_results.write('pcoa_results.txt')
# Plot with matplotlib
import matplotlib.pyplot as plt
plt.scatter(pc1, pc2)
plt.xlabel(f'PC1 ({prop_explained[0]*100:.1f}%)')
plt.ylabel(f'PC2 ({prop_explained[1]*100:.1f}%)')Canonical Correspondence Analysis (CCA)
from skbio.stats.ordination import cca
import pandas as pd
import numpy as np
# Species abundance matrix (samples x species)
species = np.array([
[10, 5, 3],
[2, 8, 4],
[5, 5, 5]
])
# Environmental variables (samples x variables)
env = pd.DataFrame({
'pH': [6.5, 7.0, 6.8],
'temperature': [20, 25, 22],
'depth': [10, 15, 12]
})
# CCA
cca_results = cca(species, env,
sample_ids=['Site1', 'Site2', 'Site3'],
species_ids=['SpeciesA', 'SpeciesB', 'SpeciesC'])
# Access constrained axes
cca1 = cca_results.samples['CCA1']
cca2 = cca_results.samples['CCA2']
# Biplot scores for environmental variables
env_scores = cca_results.biplot_scoresRedundancy Analysis (RDA)
from skbio.stats.ordination import rda
# Similar to CCA but for linear relationships
rda_results = rda(species, env,
sample_ids=['Site1', 'Site2', 'Site3'],
species_ids=['SpeciesA', 'SpeciesB', 'SpeciesC'])Statistical Tests
PERMANOVA
from skbio.stats.distance import permanova
from skbio import DistanceMatrix
import numpy as np
# Distance matrix
dm = DistanceMatrix(...)
# Grouping variable
grouping = ['Group1', 'Group1', 'Group2', 'Group2', 'Group3', 'Group3']
# Run PERMANOVA
results = permanova(dm, grouping, permutations=999)
print(f"Test statistic: {results['test statistic']}")
print(f"p-value: {results['p-value']}")
print(f"Sample size: {results['sample size']}")
print(f"Number of groups: {results['number of groups']}")ANOSIM
from skbio.stats.distance import anosim
# ANOSIM test
results = anosim(dm, grouping, permutations=999)
print(f"R statistic: {results['test statistic']}")
print(f"p-value: {results['p-value']}")PERMDISP
from skbio.stats.distance import permdisp
# Test homogeneity of dispersions
results = permdisp(dm, grouping, permutations=999)
print(f"F statistic: {results['test statistic']}")
print(f"p-value: {results['p-value']}")Mantel Test
from skbio.stats.distance import mantel
from skbio import DistanceMatrix
# Two distance matrices to compare
dm1 = DistanceMatrix(...) # e.g., genetic distance
dm2 = DistanceMatrix(...) # e.g., geographic distance
# Mantel test
r, p_value, n = mantel(dm1, dm2, method='pearson', permutations=999)
print(f"Correlation: {r}")
print(f"p-value: {p_value}")
print(f"Sample size: {n}")
# Spearman correlation
r_spearman, p, n = mantel(dm1, dm2, method='spearman', permutations=999)Partial Mantel Test
from skbio.stats.distance import mantel
# Control for a third matrix
dm3 = DistanceMatrix(...) # controlling variable
r_partial, p_value, n = mantel(dm1, dm2, method='pearson',
permutations=999, alternative='two-sided')Distance Matrices
Creating and Manipulating Distance Matrices
from skbio import DistanceMatrix
from skbio.stats.distance import PairwiseMatrix
import numpy as np
# Create from array
data = np.array([[0, 1, 2],
[1, 0, 3],
[2, 3, 0]])
dm = DistanceMatrix(data, ids=['A', 'B', 'C'])
# Access elements
dist_ab = dm['A', 'B']
row_a = dm['A']
# Slicing
subset_dm = dm.filter(['A', 'C'])
# General/asymmetric matrix: PairwiseMatrix (renamed from DissimilarityMatrix,
# which is kept as a deprecated alias)
asym_data = np.array([[0, 1, 2],
[3, 0, 4],
[5, 6, 0]])
pwm = PairwiseMatrix(asym_data, ids=['X', 'Y', 'Z'])
# Read/write
dm.write('distances.txt')
dm2 = DistanceMatrix.read('distances.txt')
# Convert to condensed form (for scipy)
condensed = dm.condensed_form()
# Convert to dataframe
df = dm.to_data_frame()File I/O
Reading Sequences
import skbio
# Read single sequence
dna = skbio.DNA.read('sequence.fasta', format='fasta')
# Read multiple sequences (generator)
for seq in skbio.io.read('sequences.fasta', format='fasta', constructor=skbio.DNA):
print(seq.metadata['id'], len(seq))
# Read into list
sequences = list(skbio.io.read('sequences.fasta', format='fasta',
constructor=skbio.DNA))
# Read FASTQ with quality scores
for seq in skbio.io.read('reads.fastq', format='fastq', constructor=skbio.DNA):
quality = seq.positional_metadata['quality']
print(f"Mean quality: {quality.mean()}")Writing Sequences
# Write single sequence
dna.write('output.fasta', format='fasta')
# Write multiple sequences
sequences = [dna1, dna2, dna3]
skbio.io.write(sequences, format='fasta', into='output.fasta')
# Write with custom line wrapping
dna.write('output.fasta', format='fasta', max_width=60)BIOM Tables
from skbio import Table
# Read BIOM table
table = Table.read('table.biom', format='hdf5')
# Access data
sample_ids = table.ids(axis='sample')
feature_ids = table.ids(axis='observation')
matrix = table.matrix_data.toarray() # if sparse
# Filter samples
abundant_samples = table.filter(lambda row, id_, md: row.sum() > 1000, axis='sample')
# Filter features (OTUs/ASVs)
prevalent_features = table.filter(lambda col, id_, md: (col > 0).sum() >= 3,
axis='observation')
# Normalize
relative_abundance = table.norm(axis='sample', inplace=False)
# Write
table.write('filtered_table.biom', format='hdf5')Format Conversion
# FASTQ to FASTA
seqs = skbio.io.read('input.fastq', format='fastq', constructor=skbio.DNA)
skbio.io.write(seqs, format='fasta', into='output.fasta')
# GenBank to FASTA
seqs = skbio.io.read('genes.gb', format='genbank', constructor=skbio.DNA)
skbio.io.write(seqs, format='fasta', into='genes.fasta')Troubleshooting
Common Issues and Solutions
Issue: "ValueError: Ids must be unique"
# Problem: Duplicate sequence IDs
# Solution: Make IDs unique or filter duplicates
seen = set()
unique_seqs = []
for seq in sequences:
if seq.metadata['id'] not in seen:
unique_seqs.append(seq)
seen.add(seq.metadata['id'])Issue: "ValueError: Counts must be integers"
# Problem: Relative abundances instead of counts
# Solution: Convert to integer counts or use appropriate metrics
counts_int = (abundance_table * 1000).astype(int)Issue: Memory error with large files
# Problem: Loading entire file into memory
# Solution: Use generators
for seq in skbio.io.read('huge.fasta', format='fasta', constructor=skbio.DNA):
# Process one at a time
process(seq)Issue: Tree tips don't match OTU IDs
# Problem: Mismatch between tree tip names and feature IDs
# Solution: Verify and align IDs
tree_tips = {tip.name for tip in tree.tips()}
feature_ids = set(feature_ids)
missing_in_tree = feature_ids - tree_tips
missing_in_table = tree_tips - feature_ids
# Prune tree to match table
tree_pruned = tree.shear(feature_ids)Issue: Alignment fails with sequences of different lengths
# Problem: Trying to align pre-aligned sequences
# Solution: Degap sequences first or ensure sequences are unaligned
seq1_degapped = seq1.degap()
seq2_degapped = seq2.degap()
alignment = pair_align_nucl(seq1_degapped, seq2_degapped)Performance Tips
1. Use appropriate data structures: BIOM HDF5 for large tables, generators for large sequence files 2. Parallel processing: Use partial_beta_diversity() for subset calculations that can be parallelized 3. Subsample large datasets: For exploratory analysis, work with subsampled data first 4. Cache results: Save distance matrices and ordination results to avoid recomputation
Integration Examples
With pandas
import pandas as pd
from skbio import DistanceMatrix
# Distance matrix to DataFrame
dm = DistanceMatrix(...)
df = dm.to_data_frame()
# Alpha diversity to DataFrame
alpha = alpha_diversity('shannon', counts, ids=sample_ids)
alpha_df = pd.DataFrame({'shannon': alpha})With matplotlib/seaborn
import matplotlib.pyplot as plt
import seaborn as sns
# PCoA plot
fig, ax = plt.subplots()
scatter = ax.scatter(pc1, pc2, c=grouping, cmap='viridis')
ax.set_xlabel(f'PC1 ({prop_explained[0]*100:.1f}%)')
ax.set_ylabel(f'PC2 ({prop_explained[1]*100:.1f}%)')
plt.colorbar(scatter)
# Heatmap of distance matrix
sns.heatmap(dm.to_data_frame(), cmap='viridis')With QIIME 2
# scikit-bio objects are compatible with QIIME 2
# Export from QIIME 2
# qiime tools export --input-path table.qza --output-path exported/
# Read in scikit-bio
table = Table.read('exported/feature-table.biom')
# Process with scikit-bio
# ...
# Import back to QIIME 2 if needed
table.write('processed-table.biom')
# qiime tools import --input-path processed-table.biom --output-path processed.qza